LsgRNA-MS2
(Plasmid
#235597)
-
Purpose(Empty Backbone) sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. The cloning site is BsmbI.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235597 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression, CRISPR
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.29.615716 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LsgRNA-MS2 was a gift from Ting Zhou (Addgene plasmid # 235597 ; http://n2t.net/addgene:235597 ; RRID:Addgene_235597) -
For your References section:
Leveraging CRISPR activation for rapid assessment of gene editing products in human pluripotent stem cells. Wu Y, Zhong A, Evangelisti A, Sidharta M, Danwei H, Studer L, Zhou T. Stem Cell Reports. 2025 Apr 25:102499. doi: 10.1016/j.stemcr.2025.102499. 10.1016/j.stemcr.2025.102499 PubMed 40345204
Map uploaded by the depositor.
