pLV-MVPH
(Plasmid
#235600)
-
PurposeExpresses the MS2-VP64-P65-HSF1 fusion protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 235600 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2-VP64-P65-HSF1
-
MutationN55K in MS2
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.29.615716 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-MVPH was a gift from Ting Zhou (Addgene plasmid # 235600 ; http://n2t.net/addgene:235600 ; RRID:Addgene_235600) -
For your References section:
Leveraging CRISPR activation for rapid assessment of gene editing products in human pluripotent stem cells. Wu Y, Zhong A, Evangelisti A, Sidharta M, Danwei H, Studer L, Zhou T. Stem Cell Reports, Volume 0, Issue 0, 102499 10.1016/j.stemcr.2025.102499