Skip to main content

PECAM1-3'gRNA
(Plasmid #235606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235606 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988)
  • Backbone manufacturer
    Feng Zhang laboratory
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PECAM1 gRNA
  • gRNA/shRNA sequence
    (G)TTGATGGAACTTAGACAGCA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    PECAM1 (a.k.a. CD31, CD31/EndoCAM, GPIIA', PECA1, PECAM-1, endoCAM)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO1.5: GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PECAM1-3'gRNA was a gift from Kai Wang (Addgene plasmid # 235606 ; http://n2t.net/addgene:235606 ; RRID:Addgene_235606)
  • For your References section:

    A novel quantitative angiogenesis assay based on visualized vascular organoid. Zhao Y, Sun M, Pan Z, Kong W, Hong Z, Zhang W, Sun B, Zhang J, Wang X, Wang K. Angiogenesis. 2025 Jan 3;28(1):10. doi: 10.1007/s10456-024-09967-z. 10.1007/s10456-024-09967-z PubMed 39751990