PECAM1-3'gRNA
(Plasmid
#235606)
-
PurposegRNA targeting PECAM1 3' terminal for CRISPR-Cas9-mediated knock-in
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988)
-
Backbone manufacturerFeng Zhang laboratory
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePECAM1 gRNA
-
gRNA/shRNA sequence(G)TTGATGGAACTTAGACAGCA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)21
-
Entrez GenePECAM1 (a.k.a. CD31, CD31/EndoCAM, GPIIA', PECA1, PECAM-1, endoCAM)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO1.5: GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PECAM1-3'gRNA was a gift from Kai Wang (Addgene plasmid # 235606 ; http://n2t.net/addgene:235606 ; RRID:Addgene_235606) -
For your References section:
A novel quantitative angiogenesis assay based on visualized vascular organoid. Zhao Y, Sun M, Pan Z, Kong W, Hong Z, Zhang W, Sun B, Zhang J, Wang X, Wang K. Angiogenesis. 2025 Jan 3;28(1):10. doi: 10.1007/s10456-024-09967-z. 10.1007/s10456-024-09967-z PubMed 39751990