pcDNA3.1-HA-RAD52-∆C
(Plasmid
#235677)
-
PurposeExpresses HA-tagged mutant human RAD52 in mammalian cells with a C-terminal deletion (Δ302-410 amino acids).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 235677 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)-N-HA
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAD52
-
SpeciesH. sapiens (human)
-
Insert Size (bp)942
-
Mutationdeleted amino acids 302-410
-
GenBank IDNM_134424.4
-
Entrez GeneRAD52
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-HA-RAD52-∆C was a gift from Simon Powell (Addgene plasmid # 235677 ; http://n2t.net/addgene:235677 ; RRID:Addgene_235677) -
For your References section:
RAD52 resolves transcription-replication conflicts to mitigate R-loop induced genome instability. Jalan M, Sharma A, Pei X, Weinhold N, Buechelmaier ES, Zhu Y, Ahmed-Seghir S, Ratnakumar A, Di Bona M, McDermott N, Gomez-Aguilar J, Anderson KS, Ng CKY, Selenica P, Bakhoum SF, Reis-Filho JS, Riaz N, Powell SN. Nat Commun. 2024 Sep 5;15(1):7776. doi: 10.1038/s41467-024-51784-x. 10.1038/s41467-024-51784-x PubMed 39237529