AAV-SC4
(Plasmid
#236254)
-
PurposeAAV-SC4 capsid which targets peripheral nerves in mice
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAR9
- Total vector size (bp) 7483
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namerep/cap AAV9 VP1 with GATPSTQ peptide insert
-
Speciesparvovirus
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer GTGCTTCATTCCAAACCCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namerep
-
Speciesaav
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-SC4 was a gift from Casey Maguire (Addgene plasmid # 236254 ; http://n2t.net/addgene:236254 ; RRID:Addgene_236254) -
For your References section:
Engineered AAV capsids mediate transduction of murine neurofibroma and sciatic nerve. Abou Haidar E, Prabhakar S, Cheah PS, Hanlon KS, Espinoza P, Crain AV, Patel N, Radcliff GW, Cheng M, Hernandez IC, Minderler S, de la Cruz D, Ng C, da Hora CC, Charest A, Stemmer-Rachamimov A, Jowett N, Breakefield XO, Maguire CA. Gene Ther. 2025 Jun 10. doi: 10.1038/s41434-025-00542-9. 10.1038/s41434-025-00542-9 PubMed 40494929