pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2
(Plasmid
#236731)
-
PurposeDual sgRNA targeting TIMM23 expressing BFP with Puromycin selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti_DualsgRNA_EmptyVector_Puro_T2A_TagBFP2
-
Backbone manufacturerDerek Narendra, Addgene plasmid #236729
- Backbone size w/o insert (bp) 9585
- Total vector size (bp) 9958
-
Modifications to backbonepLenti_DualsgRNA_EmptyVector_Puro_T2A_TagBFP2 digested with BsmBI and ligated with "TIMM23 fragment" via NEBuilder.
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTIMM23
-
gRNA/shRNA sequenceGTTGAGGAGTAACGGCCCAG, GGAAGGTCAGCGTGTGAAGT
-
SpeciesH. sapiens (human)
-
Entrez GeneTIMM23 (a.k.a. TIM23)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.19.639160 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2 was a gift from Derek Narendra (Addgene plasmid # 236731 ; http://n2t.net/addgene:236731 ; RRID:Addgene_236731) -
For your References section:
A unified mechanism for mitochondrial damage sensing in PINK1-Parkin-mediated mitophagy. Thayer JA, Petersen JD, Huang X, Gruel Budet LM, Hawrot J, Ramos DM, Sekine S, Li Y, Ward ME, Narendra DP. EMBO J. 2025 Nov 20. doi: 10.1038/s44318-025-00604-z. 10.1038/s44318-025-00604-z PubMed 41266657