pET-28c-F30-2xdBroccoli-47CAG
(Plasmid
#237217)
-
PurposeExpress F30-2xdBroccoli tagged 47 repeats of CAG RNA in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 237217 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28c-F30-2xdBroccoli
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5445
- Total vector size (bp) 5637
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name47 CAG trinucleotide repeats RNA
-
SpeciesSynthetic
-
Insert Size (bp)192
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ggtgatgtcggcgatatagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28c-F30-2xdBroccoli-47CAG was a gift from Mingxu You (Addgene plasmid # 237217 ; http://n2t.net/addgene:237217 ; RRID:Addgene_237217) -
For your References section:
Targeted RNA condensation in living cells via genetically encodable triplet repeat tags. Xue Z, Ren K, Wu R, Sun Z, Zheng R, Tian Q, Ali AA, Mi L, You M. Nucleic Acids Res. 2023 Sep 8;51(16):8337-8347. doi: 10.1093/nar/gkad621. 10.1093/nar/gkad621 PubMed 37486784