S17-1λpir gyrAR462C
(Bacterial strain #237425)

• Purpose: This engineered E. coli S17-1 λpir strain, featuring a mutation in the gyrA gene (462Arg→Cys), was designed to confer resistance to the CcdB toxin, allowing it to survive with a ccdB-carrying plasmid.
• Depositing Lab: Xue Liu
• Publication: Zhang et al Nat Commun. 2025 Jul 1;16(1):5870. doi: 10.1038/s41467-025-61208-z.

Backbone

• Vector backbone: n/a
• Vector type: This is a strain, not a plasmid

Growth in Bacteria

• Bacterial Resistance(s): None
• Growth Temperature: 37°C
• Growth Strain(s): S17-1λpir gyrAR462C
• Growth instructions: *See notes in Comments section.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: none
• Species: n/a

Cloning Information

• Cloning method: Unknown

Resource Information

• Supplemental Documents:
  • Streptomycin&Trimethoprim test.pdf
  • gyrA462 mutation.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C

To verify the gyrA gene using the following primers:
gyrA462-F: cccgtcgtactattttcgaac
gyrA462-R: cagcagtcggtcgataaagtc
The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference.

Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above.

Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact if any issues arise.