S17-1λpir gyrAR462C
(Bacterial strain
#237425)
-
PurposeThis engineered E. coli S17-1 λpir strain, featuring a mutation in the gyrA gene (462Arg→Cys), was designed to confer resistance to the CcdB toxin, allowing it to survive with a ccdB-carrying plasmid.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 237425 | Bacteria in agar stab | 1 | $89 | |
Backbone
-
Vector backbonen/a
-
Vector typeThis is a strain, not a plasmid
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)S17-1λpir gyrAR462C
-
Growth instructions*See notes in Comments section.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenone
-
Speciesn/a
Cloning Information
- Cloning method Unknown
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C
To verify the gyrA gene using the following primers:
gyrA462-F: cccgtcgtactattttcgaac
gyrA462-R: cagcagtcggtcgataaagtc
The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference.
Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above.
Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
S17-1λpir gyrAR462C was a gift from Xue Liu (Addgene plasmid # 237425) -
For your References section:
CRISPRi screen identifies FprB as a synergistic target for gallium therapy in Pseudomonas aeruginosa. Zhang Y, Zhang T, Xiao X, Wang Y, Kawalek A, Ou J, Ren A, Sun W, de Bakker V, Liu Y, Li Y, Yang L, Ye L, Jia N, Veening JW, Liu X. Nat Commun. 2025 Jul 1;16(1):5870. doi: 10.1038/s41467-025-61208-z. 10.1038/s41467-025-61208-z PubMed 40595632