pT7-TaGu-END-3xF-ORF
(Plasmid
#238489)
-
PurposeFor production of C-term flag-tagged TaGu EN-dead ORF mRNA for mRNA transfection in PRINT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238489 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57min
-
Vector typeIVT template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameR2 retroelement mRNA
-
SpeciesTaeniopygia guttata
-
MutationDD1057/1070->AA
-
Tag
/ Fusion Protein
- 3x-Flag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-TaGu-END-3xF-ORF was a gift from Kathleen Collins (Addgene plasmid # 238489 ; http://n2t.net/addgene:238489 ; RRID:Addgene_238489) -
For your References section:
Harnessing eukaryotic retroelement proteins for transgene insertion into human safe-harbor loci. Zhang X, Van Treeck B, Horton CA, McIntyre JJR, Palm SM, Shumate JL, Collins K. Nat Biotechnol. 2024 Feb 20. doi: 10.1038/s41587-024-02137-y. 10.1038/s41587-024-02137-y PubMed 38379101