pMSCV-RUNX1-4A
(Plasmid
#238534)
-
PurposeUsed for overexpression of human RUNX1 in mammalian cells. Contains mutations that prevent phosphorylation at some sites of the translated protein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-F-BirA
- Backbone size w/o insert (bp) 5202
- Total vector size (bp) 7709
-
Modifications to backboneAdded human RUNX1 driven by MSCV, and Puromycin driven by the PGK promoter
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameRUNX1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1343
-
MutationS249A, S266A, T273A, S276A
-
GenBank IDXM_054324894.1
-
Entrez GeneRUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
- Promoter MSCV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTGAGCCCAGGCAAGATGAG
- 3′ sequencing primer gagcatgcgctttagcagcc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuromycin
-
Insert Size (bp)600
-
GenBank IDON783971.1
- Promoter PGK
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer cggcattctgcacgcttcaa
- 3′ sequencing primer aggggttgtgggctctttta
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-RUNX1-4A was a gift from Diane Krause (Addgene plasmid # 238534 ; http://n2t.net/addgene:238534 ; RRID:Addgene_238534) -
For your References section:
CDK9 phosphorylates RUNX1 to promote megakaryocytic fate in megakaryocytic-erythroid progenitors. Kwon N, Lu YC, Thompson EN, Mancuso RI, Wang L, Zhang PX, Krause DS. Blood. 2024 Oct 24;144(17):1800-1812. doi: 10.1182/blood.2024023963. 10.1182/blood.2024023963 PubMed 39102635