miniCMV-iRFP670-24xMS2
(Plasmid
#238915)
-
PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motif
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUB_smFLAG_KDM5B_MS2
-
Backbone manufacturerTim Stasevich (Addgene #81084)
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiRFP670-24xMS2
-
SpeciesSynthetic
- Promoter miniCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed) (unknown if destroyed)
- 3′ cloning site BsrGI(not destroyed) (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miniCMV-iRFP670-24xMS2 was a gift from Jian-Hui Jiang (Addgene plasmid # 238915 ; http://n2t.net/addgene:238915 ; RRID:Addgene_238915) -
For your References section:
Fluorogenic Interacting Protein Stabilization for Orthogonal RNA Imaging. Zhou WJ, Wu MY, Shao XJ, Tang LJ, Wang F, Jiang JH. Angew Chem Int Ed Engl. 2025 Apr 10:e202502350. doi: 10.1002/anie.202502350. 10.1002/anie.202502350 PubMed 40208703