pGP-AAV-syn-FLEX-Positron2-ST-WPRE
(Plasmid
#239080)
-
PurposeAAV-mediated expression of positive-going voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequence
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-Syn-FLEX
-
Backbone manufacturerScott Sternson
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePositron2-ST
-
Alt namePositron2-ST insert
-
Alt namevariant 508.6237
-
SpeciesSynthetic
-
Insert Size (bp)1854
-
MutationR78K N81D D92N W178F
- Promoter hSynapsin1
-
Tag
/ Fusion Protein
- soma localization targeting sequence (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer ACCACGCGAGGCGCGAGATAG
- 3′ sequencing primer TTAAAGCAGCGTATCCACAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP-AAV-syn-FLEX-Positron2-ST-WPRE was a gift from GENIE Project (Addgene plasmid # 239080 ; http://n2t.net/addgene:239080 ; RRID:Addgene_239080) -
For your References section:
Optimization of Ace2N based voltage indicators. Eric R. Schreiter, Ahmed Abdelfattah, Jeremy Hasseman, Daniel Reep, Getahun Tsegaye, Arthur Tsang, Ilya Kolb, Allan Wong, Amy Chuong, Jihong Zheng, Ben Arthur, Wyatt Korff, GENIE Project Team. Janelia Figshare 2023 10.25378/janelia.22325446.v1