pGP-AAV-syn-FLEX-Positron2-ST-WPRE
(Plasmid #239080)

• Purpose: AAV-mediated expression of positive-going voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequence
• Depositing Lab: GENIE Project
• Publication: Eric R. et al Janelia Figshare 2023

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-Syn-FLEX
• Backbone manufacturer: Scott Sternson
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Positron2-ST
• Alt name: Positron2-ST insert
• Alt name: variant 508.6237
• Species: Synthetic
• Insert Size (bp): 1854
• Mutation: R78K N81D D92N W178F
• Promoter: hSynapsin1
• Tag / Fusion Protein:
  • soma localization targeting sequence (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: ACCACGCGAGGCGCGAGATAG
• 3′ sequencing primer: TTAAAGCAGCGTATCCACAT

Resource Information

• Supplemental Documents:
  • pGP-AAV-syn-FLEX-Positron2-ST-WPRE.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry