Skip to main content

pGP-AAV-syn-FLEX-Positron2-ST-WPRE
(Plasmid #239080)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239080 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Syn-FLEX
  • Backbone manufacturer
    Scott Sternson
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Positron2-ST
  • Alt name
    Positron2-ST insert
  • Alt name
    variant 508.6237
  • Species
    Synthetic
  • Insert Size (bp)
    1854
  • Mutation
    R78K N81D D92N W178F
  • Promoter hSynapsin1
  • Tag / Fusion Protein
    • soma localization targeting sequence (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer ACCACGCGAGGCGCGAGATAG
  • 3′ sequencing primer TTAAAGCAGCGTATCCACAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-AAV-syn-FLEX-Positron2-ST-WPRE was a gift from GENIE Project (Addgene plasmid # 239080 ; http://n2t.net/addgene:239080 ; RRID:Addgene_239080)
  • For your References section:

    Optimization of Ace2N based voltage indicators. Eric R. Schreiter, Ahmed Abdelfattah, Jeremy Hasseman, Daniel Reep, Getahun Tsegaye, Arthur Tsang, Ilya Kolb, Allan Wong, Amy Chuong, Jihong Zheng, Ben Arthur, Wyatt Korff, GENIE Project Team. Janelia Figshare 2023 10.25378/janelia.22325446.v1