Skip to main content

P530_SIX6-p2A-h2b-EGFP
(Plasmid #239101)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239101 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5310
  • Vector type
    Mammalian Expression ; Donor plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SIX6
  • Species
    H. sapiens (human)
  • Entrez Gene
    SIX6 (a.k.a. MCOPCT2, ODRMD, OPTX2, Six9)
  • Promoter Endogenous SIX6 promoter
  • Tag / Fusion Protein
    • p2A-h2b-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTAGTGCGCGAGCAAAAT
  • 3′ sequencing primer GAGTCAGTGAGCGAGGAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P530_SIX6-p2A-h2b-EGFP was a gift from Karl Wahlin (Addgene plasmid # 239101 ; http://n2t.net/addgene:239101 ; RRID:Addgene_239101)
  • For your References section:

    CRISPR Generated SIX6 and POU4F2 Reporters Allow Identification of Brain and Optic Transcriptional Differences in Human PSC-Derived Organoids. Wahlin KJ, Cheng J, Jurlina SL, Jones MK, Dash NR, Ogata A, Kibria N, Ray S, Eldred KC, Kim C, Heng JS, Phillips J, Johnston RJ Jr, Gamm DM, Berlinicke C, Zack DJ. Front Cell Dev Biol. 2021 Nov 16;9:764725. doi: 10.3389/fcell.2021.764725. eCollection 2021. 10.3389/fcell.2021.764725 PubMed 34869356