BAC-GWS1B
(Plasmid
#239581)
-
PurposeSingle copy expression vector for GWS1B Rubisco
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBAC
-
Backbone manufacturerAddgene (85710)
- Backbone size w/o insert (bp) 8029
- Total vector size (bp) 9420
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGWS1B Rubisco (6X his)
-
SpeciesGallionellaceae
-
Insert Size (bp)1392
-
MutationWild-type
-
GenBank IDALP32085.1
- Promoter T7, tac
-
Tag
/ Fusion Protein
- 6X histag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aacaggaaggcaaaatgccg
- 3′ sequencing primer ataaagtgcaagcaatacgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.17.638297 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BAC-GWS1B was a gift from Matthew D. Shoulders (Addgene plasmid # 239581 ; http://n2t.net/addgene:239581 ; RRID:Addgene_239581) -
For your References section:
In vivo directed evolution of an ultrafast Rubisco from a semianaerobic environment imparts oxygen resistance. McDonald JL, Shapiro NP, Mengiste AA, Kaines S, Whitney SM, Wilson RH, Shoulders MD. Proc Natl Acad Sci U S A. 2025 Jul 8;122(27):e2505083122. doi: 10.1073/pnas.2505083122. Epub 2025 Jun 30. 10.1073/pnas.2505083122 PubMed 40587785