nCaMK2rep
(Plasmid
#239624)
-
PurposeCaMKII activity reporter. The lentiviral plasmid contains a nanobody sequence (PSD95.FingR), 3xmyc tags and double phospho-site 3 from rat Synapsin-1a.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.7
- Backbone size w/o insert (bp) 6324
- Total vector size (bp) 7098
-
Modifications to backboneVector backbone is derived from the plasmid SYN-DsRed-SYN-GFP (S.Gascon et al., 2008). The plasmid was digested using the enzymes BamHI and NheI, resulting in a single promoter
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePSD95.FingR-NES-SynP3-3xmyc
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)774
-
GenBank IDNM_019133.2
-
Entrez GeneSyn1
- Promoter hSyn
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- myc (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCAGTCTGCGGTGGGCAGC
- 3′ sequencing primer CAACATAGTTAAGAATACCAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.07.652623 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nCaMK2rep was a gift from F Javier Díez Guerra (Addgene plasmid # 239624 ; http://n2t.net/addgene:239624 ; RRID:Addgene_239624) -
For your References section:
CaMK2rep: A Highly Sensitive Genetically Encoded Biosensor for Monitoring CaMKII Activity in Mammalian Cells. Martinez-Blanco E, de Andres R, Baratas-Alvarez L, Diez-Guerra FJ. Anal Chem. 2025 Sep 23;97(37):20275-20290. doi: 10.1021/acs.analchem.5c03227. Epub 2025 Sep 14. 10.1021/acs.analchem.5c03227 PubMed 40947561