pAAV-pBG-mCRE98-NLS-EGFP-WPRE
(Plasmid
#239977)
-
Purposeadeno-associated virus (AAV) encoding enhanced green fluorescent protein (eGFP) under motor neuron-selective control of minimal beta globin promoter (pBG) and CRE98
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 239977 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-mDlx-GFP-Fishell-1
-
Backbone manufacturerGordon Fishell (Addgene plasmid # 83900)
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)716
-
Entrez GeneeGFP (a.k.a. pPRS3a_01)
- Promoter pBG + mCRE98
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atttgtgaaagattgactggtattcttaactatgttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-pBG-mCRE98-NLS-EGFP-WPRE was a gift from Sinisa Hrvatin (Addgene plasmid # 239977 ; http://n2t.net/addgene:239977 ; RRID:Addgene_239977) -
For your References section:
Cis-regulatory elements driving motor neuron-selective viral payload expression within the mammalian spinal cord. Nagy MA, Price S, Wang K, Gill S, Ren E, Jayne L, Pajak V, Deighan S, Liu B, Lu X, Diallo A, Lo SC, Kleiman R, Henderson C, Suh J, Griffith EC, Greenberg ME, Hrvatin S. Proc Natl Acad Sci U S A. 2024 Dec 3;121(49):e2418024121. doi: 10.1073/pnas.2418024121. Epub 2024 Nov 27. 10.1073/pnas.2418024121 PubMed 39602276