6xHsa.NFKB:d2mRFP1
(Plasmid
#239991)
-
PurposeDestabilized red fluorescent protein (d2mRFP1) under transcriptional control of NF-kB activation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNFkB:EGFP
-
Backbone manufacturerJohn Rawls (Addgene plasmid #44922)
- Backbone size w/o insert (bp) 6524
- Total vector size (bp) 7321
-
Modifications to backboneThe eGFP from pNFkB:EGFP backbone was excised using ClaI (R0197S, NEB) and NcoI-HF (R3193S, NEB) following the manufacturers’ instructions.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemRFP1
-
Insert Size (bp)675
- Promoter cfos minimal promoter
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggctttccccaaacttcgagatggcctcctccgagg acgtc
- 3′ sequencing primer ctccggcgggaagccatggctaagcttggcgccg gtggagtggcg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePEST
-
Insert Size (bp)122
- Promoter cfos minimal promoter
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gccatggcttcccgccggaggtggaggagcagga tgatg
- 3′ sequencing primer tatcatgtctggatcatcatcgatctacacattgatcct agcagaagc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene was amplified from a plasmid by PCR and subcloned into pNFkB backbone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6xHsa.NFKB:d2mRFP1 was a gift from Raquel Espin-Palazon (Addgene plasmid # 239991 ; http://n2t.net/addgene:239991 ; RRID:Addgene_239991) -
For your References section:
p65 signaling dynamics drive the developmental progression of hematopoietic stem and progenitor cells through cell cycle regulation. Campbell CA, Calderon R, Pavani G, Cheng X, Barakat R, Snella E, Liu F, Peng X, Essner JJ, Dorman KS, McGrail M, Gadue P, French DL, Espin-Palazon R. Nat Commun. 2024 Sep 6;15(1):7787. doi: 10.1038/s41467-024-51922-5. 10.1038/s41467-024-51922-5 PubMed 39242546