6xHsa.NFKB:d2mRFP1
(Plasmid #239991)

• Purpose: Destabilized red fluorescent protein (d2mRFP1) under transcriptional control of NF-kB activation
• Depositing Lab: Raquel Espin-Palazon
• Publication: p65 signaling dynamics drive the developmental progression of hematopoietic stem and progenitor cells through cell cycle regulation. (unpublished)

Backbone

• Vector backbone: pNFkB:EGFP
• Backbone manufacturer: John Rawls (Addgene plasmid #44922)
• Backbone size w/o insert (bp): 6524
• Total vector size (bp): 7321
• Modifications to backbone: The eGFP from pNFkB:EGFP backbone was excised using ClaI (R0197S, NEB) and NcoI-HF (R3193S, NEB) following the manufacturers’ instructions.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: mRFP1
• Insert Size (bp): 675
• Promoter: cfos minimal promoter

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ggctttccccaaacttcgagatggcctcctccgagg acgtc
• 3′ sequencing primer: ctccggcgggaagccatggctaagcttggcgccg gtggagtggcg

Gene/Insert 2

• Gene/Insert name: PEST
• Insert Size (bp): 122
• Promoter: cfos minimal promoter

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gccatggcttcccgccggaggtggaggagcagga tgatg
• 3′ sequencing primer: tatcatgtctggatcatcatcgatctacacattgatcct agcagaagc

Resource Information

• Supplemental Documents:
  • cpE_60 NFkB binding sites Destabilized-mRFP updated.gb
• A portion of this plasmid was derived from a plasmid made by: Gene was amplified from a plasmid by PCR and subcloned into pNFkB backbone

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry