Skip to main content

6xHsa.NFKB:d2mRFP1
(Plasmid #239991)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239991 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNFkB:EGFP
  • Backbone manufacturer
    John Rawls (Addgene plasmid #44922)
  • Backbone size w/o insert (bp) 6524
  • Total vector size (bp) 7321
  • Modifications to backbone
    The eGFP from pNFkB:EGFP backbone was excised using ClaI (R0197S, NEB) and NcoI-HF (R3193S, NEB) following the manufacturers’ instructions.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mRFP1
  • Insert Size (bp)
    675
  • Promoter cfos minimal promoter

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggctttccccaaacttcgagatggcctcctccgagg acgtc
  • 3′ sequencing primer ctccggcgggaagccatggctaagcttggcgccg gtggagtggcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PEST
  • Insert Size (bp)
    122
  • Promoter cfos minimal promoter

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gccatggcttcccgccggaggtggaggagcagga tgatg
  • 3′ sequencing primer tatcatgtctggatcatcatcgatctacacattgatcct agcagaagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gene was amplified from a plasmid by PCR and subcloned into pNFkB backbone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6xHsa.NFKB:d2mRFP1 was a gift from Raquel Espin-Palazon (Addgene plasmid # 239991 ; http://n2t.net/addgene:239991 ; RRID:Addgene_239991)
  • For your References section:

    p65 signaling dynamics drive the developmental progression of hematopoietic stem and progenitor cells through cell cycle regulation. Campbell CA, Calderon R, Pavani G, Cheng X, Barakat R, Snella E, Liu F, Peng X, Essner JJ, Dorman KS, McGrail M, Gadue P, French DL, Espin-Palazon R. Nat Commun. 2024 Sep 6;15(1):7787. doi: 10.1038/s41467-024-51922-5. 10.1038/s41467-024-51922-5 PubMed 39242546