Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mNeonGreen-Smad3
(Plasmid #172098)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172098 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    SuperBackbone
  • Backbone manufacturer
    NA
  • Backbone size w/o insert (bp) 5129
  • Total vector size (bp) 7118
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Smad 3
  • Alt name
    SMAD family member 3
  • Alt name
    Mothers against decapentaplegic homolog 3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1989
  • Mutation
    C49S mutation in mCerulean
  • GenBank ID
    NM_016769.4
  • Entrez Gene
    Smad3 (a.k.a. Madh3)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cttaccccaacgacaaaacc
  • 3′ sequencing primer ACTTGTTTATTGCAGCTTATAATGGTTAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Human Smad3 cDNA was a gift from Joan Massague (Addgene plasmid #27010), mNeonGreen (NG) gene was obtained from Allele Biotechnology (ABP-FP-MNEONSA), mCerulean3-C1 cDNA was a gift from Klaus Hahn (Addgene plasmid #22030)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Human Smad3 and mouse Smad3 contain 100% sequence identity. The NG-Smad3 construct was placed downstream of a CMV promoter, and the mCerulean3 gene was fused with a 3× nuclear localization sequence (NLS) and placed downstream of an SV40 promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mNeonGreen-Smad3 was a gift from Lea Goentoro (Addgene plasmid # 172098 ; http://n2t.net/addgene:172098 ; RRID:Addgene_172098)
  • For your References section:

    Sensing relative signal in the Tgf-beta/Smad pathway. Frick CL, Yarka C, Nunns H, Goentoro L. Proc Natl Acad Sci U S A. 2017 Apr 4;114(14):E2975-E2982. doi: 10.1073/pnas.1611428114. Epub 2017 Mar 20. 10.1073/pnas.1611428114 PubMed 28320972