mNeonGreen-Smad3
(Plasmid #172098)

• Purpose: Expresses fluorescently tagged human Smad3 in mammalian cells.
• Depositing Lab: Lea Goentoro
• Publication: Frick et al Proc Natl Acad Sci U S A. 2017 Apr 4;114(14):E2975-E2982. doi: 10.1073/pnas.1611428114. Epub 2017 Mar 20.

Backbone

• Vector backbone: SuperBackbone
• Backbone manufacturer: NA
• Backbone size w/o insert (bp): 5129
• Total vector size (bp): 7118
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Smad 3
• Alt name: SMAD family member 3
• Alt name: Mothers against decapentaplegic homolog 3
• Species: M. musculus (mouse)
• Insert Size (bp): 1989
• Mutation: C49S mutation in mCerulean
• GenBank ID: NM_016769.4
• Entrez Gene: Smad3 (a.k.a. Madh3)
• Promoter: CMV
• Tag / Fusion Protein:
  • mNeonGreen (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cttaccccaacgacaaaacc
• 3′ sequencing primer: ACTTGTTTATTGCAGCTTATAATGGTTAC

Resource Information

• Supplemental Documents:
  • mneongreen-msmad3-superbackbone.gb
• A portion of this plasmid was derived from a plasmid made by: Human Smad3 cDNA was a gift from Joan Massague (Addgene plasmid #27010), mNeonGreen (NG) gene was obtained from Allele Biotechnology (ABP-FP-MNEONSA), mCerulean3-C1 cDNA was a gift from Klaus Hahn (Addgene plasmid #22030)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Human Smad3 and mouse Smad3 contain 100% sequence identity. The NG-Smad3 construct was placed downstream of a CMV promoter, and the mCerulean3 gene was fused with a 3× nuclear localization sequence (NLS) and placed downstream of an SV40 promoter.