Skip to main content
Addgene

pIDTsmart-RC2-WT
(Plasmid #240057)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240057 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pIDTsmart
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV2-WT Rep Cap
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4225

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gctctagaactagtggatcccccgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIDTsmart-RC2-WT was a gift from Abhishek Chatterjee (Addgene plasmid # 240057 ; http://n2t.net/addgene:240057 ; RRID:Addgene_240057)
  • For your References section:

    Precise Manipulation of the Site and Stoichiometry of Capsid Modification Enables Optimization of Functional Adeno-Associated Virus Conjugates. Erickson SB, Pham Q, Cao X, Glicksman J, Kelemen RE, Shahraeini SS, Bodkin S, Kiyam Z, Chatterjee A. Bioconjug Chem. 2024 Jan 17;35(1):64-71. doi: 10.1021/acs.bioconjchem.3c00411. Epub 2023 Dec 16. 10.1021/acs.bioconjchem.3c00411 PubMed 38103182