pIDTsmart-RC2-WT
(Plasmid
#240057)
-
PurposeExpress AAV2 WT capsid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIDTsmart
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV2-WT Rep Cap
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4225
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gctctagaactagtggatcccccgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIDTsmart-RC2-WT was a gift from Abhishek Chatterjee (Addgene plasmid # 240057 ; http://n2t.net/addgene:240057 ; RRID:Addgene_240057) -
For your References section:
Precise Manipulation of the Site and Stoichiometry of Capsid Modification Enables Optimization of Functional Adeno-Associated Virus Conjugates. Erickson SB, Pham Q, Cao X, Glicksman J, Kelemen RE, Shahraeini SS, Bodkin S, Kiyam Z, Chatterjee A. Bioconjug Chem. 2024 Jan 17;35(1):64-71. doi: 10.1021/acs.bioconjchem.3c00411. Epub 2023 Dec 16. 10.1021/acs.bioconjchem.3c00411 PubMed 38103182