Skip to main content

pIDTsmart-RC2-WT
(Plasmid #240057)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240057 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIDTsmart
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV2-WT Rep Cap
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4225

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gctctagaactagtggatcccccgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIDTsmart-RC2-WT was a gift from Abhishek Chatterjee (Addgene plasmid # 240057 ; http://n2t.net/addgene:240057 ; RRID:Addgene_240057)
  • For your References section:

    Precise Manipulation of the Site and Stoichiometry of Capsid Modification Enables Optimization of Functional Adeno-Associated Virus Conjugates. Erickson SB, Pham Q, Cao X, Glicksman J, Kelemen RE, Shahraeini SS, Bodkin S, Kiyam Z, Chatterjee A. Bioconjug Chem. 2024 Jan 17;35(1):64-71. doi: 10.1021/acs.bioconjchem.3c00411. Epub 2023 Dec 16. 10.1021/acs.bioconjchem.3c00411 PubMed 38103182