73-21 KRAS PANCS-binder posAP
(Plasmid
#240119)
-
PurposeKRAS G12D PANCS-binder positive AP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKRas-RNAPC Pos AP fusion
-
SpeciesH. sapiens (human), Synthetic
- Promoter custom
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACTAGAGTATCTGTTAGTTTTTTTCTACTAGAGTATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.06.631531 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
73-21 KRAS PANCS-binder posAP was a gift from Bryan Dickinson (Addgene plasmid # 240119 ; http://n2t.net/addgene:240119 ; RRID:Addgene_240119) -
For your References section:
High-throughput protein binder discovery by rapid in vivo selection. Styles MJ, Pixley JA, Wei T, Basile C, Lu SS, Dickinson BC. bioRxiv [Preprint]. 2025 Jan 17:2025.01.06.631531. doi: 10.1101/2025.01.06.631531. 10.1101/2025.01.06.631531 PubMed 39829796