73-79 ZBneg PANCS-binder negAP
(Plasmid
#240121)
-
PurposeZBneg PANCS-binder negative AP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name-ZBneg-RNAPC fusion
-
SpeciesSynthetic
- Promoter Custom
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taagaagataactaaacaactaacggaca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.06.631531 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
73-79 ZBneg PANCS-binder negAP was a gift from Bryan Dickinson (Addgene plasmid # 240121 ; http://n2t.net/addgene:240121 ; RRID:Addgene_240121) -
For your References section:
High-throughput protein binder discovery by rapid in vivo selection. Styles MJ, Pixley JA, Wei T, Basile C, Lu SS, Dickinson BC. bioRxiv [Preprint]. 2025 Jan 17:2025.01.06.631531. doi: 10.1101/2025.01.06.631531. 10.1101/2025.01.06.631531 PubMed 39829796