pminiTol2-5xUAS-hsp-sfGFP-zP2A-tetoff-zN2cG-zP2A-zTVA (UGNT-A)
(Plasmid
#240272)
-
PurposeHelper plasmid for zebrafish rabies virus based-circuit tracing
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepminiTol2
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameN2cG (codon-optimized for Danio rerio)
-
SpeciesSynthetic; Rabies virus
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gtgccccaagtgctgctgttc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesfGFP (codon-optimized for Danio rerio)
-
Alt nameSuperfolder GFP
-
SpeciesSynthetic
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer atgagcaagggagaggagctgt
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTVA (codon-optimized for Danio rerio)
-
SpeciesSynthetic
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer gctagactgctgcctgctctg
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nametetoff (codon-optimized for Danio rerio)
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer atgtctagactggacaagagcaaagtcata
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.7554/eLife.100880.1 for the eLife preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pminiTol2-5xUAS-hsp-sfGFP-zP2A-tetoff-zN2cG-zP2A-zTVA (UGNT-A) was a gift from Xufei Du (Addgene plasmid # 240272 ; http://n2t.net/addgene:240272 ; RRID:Addgene_240272) -
For your References section:
An applicable and efficient retrograde monosynaptic circuit mapping tool for larval zebrafish. Chen TL, Deng QS, Lin KZ, Zheng XD, Wang X, Zhong YW, Ning XY, Li Y, Xu FQ, Du JL, Du XF. eLife 13:RP100880 10.7554/eLife.100880.2