RPL25NLS-GFP-PRA (102)
(Plasmid
#24041)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYX242
- Backbone size w/o insert (bp) 5000
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPL25
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)135
-
MutationOnly bp 1-135 (aa 1-45) of RPL25
-
Entrez GeneRPL25 (a.k.a. YOL127W)
-
Tags
/ Fusion Proteins
- EGFP (C terminal on insert)
- PRA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer EGFP-N (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NLS of RPL25 (bp 1-135) fused upstream of eGFP in EcoRI/HindIII of pYX242 followed by a single PrA repeat in HindIII/SalI.
PrA motif sequence downstream of GFP:
GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RPL25NLS-GFP-PRA (102) was a gift from Michael Rout (Addgene plasmid # 24041 ; http://n2t.net/addgene:24041 ; RRID:Addgene_24041)