Skip to main content

G-GECO1.2 (F90L)
(Plasmid #240471)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240471 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Custom Vector
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 4457
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G-GECO1.2 (F90L)
  • Species
    Synthetic
  • Insert Size (bp)
    1257
  • Mutation
    Mutated phenylalanine 359 to leucine (GECO numbering) corresponding to the F90 of calmodulin
  • Promoter CMV

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    G-GECO1.2 (F90L) was a gift from Antony Galione (Addgene plasmid # 240471 ; http://n2t.net/addgene:240471 ; RRID:Addgene_240471)
  • For your References section:

    Optical profiling of autonomous Ca(2+) nanodomains generated by lysosomal TPC2 and TRPML1. Davis LC, Morgan AJ, Galione A. Cell Calcium. 2023 Dec;116:102801. doi: 10.1016/j.ceca.2023.102801. Epub 2023 Sep 18. 10.1016/j.ceca.2023.102801 PubMed 37742482