pCMV-MMLVgag-dCas9-ZIM3
(Plasmid
#240527)
-
PurposeExpresses MMLVgag–dCas9-ZIM3 for producing RENDER-dCas9-ZIM3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240527 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3-like
- Backbone size w/o insert (bp) 4759
- Total vector size (bp) 11917
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMMLVgag-dCas9-ZIM3
-
SpeciesSynthetic
-
Insert Size (bp)7154
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG, HA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcggctcacttcaactgcc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMMLVgag is from pCMV-MMLVgag-3xNES-ABE8e (Plasmid #181751), dCas9 is from CRISPRoff-v2.1 (Plasmid #167981), and ZIM3 sequence was obtained from previous study (Alerasool, N., Segal, D., Lee, H. & Taipale, M. An efficient KRAB domain for CRISPRi applications in human cells. Nat Methods 17, 1093–1096 (2020).) and synthesized.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-MMLVgag-dCas9-ZIM3 was a gift from James Nuñez (Addgene plasmid # 240527 ; http://n2t.net/addgene:240527 ; RRID:Addgene_240527) -
For your References section:
Programmable epigenome editing by transient delivery of CRISPR epigenome editor ribonucleoproteins. Xu D, Besselink S, Ramadoss GN, Dierks PH, Lubin JP, Pattali RK, Brim JI, Christenson AE, Colias PJ, Ornelas IJ, Nguyen CD, Chasins SE, Conklin BR, Nunez JK. Nat Commun. 2025 Aug 26;16(1):7948. doi: 10.1038/s41467-025-63167-x. 10.1038/s41467-025-63167-x PubMed 40858609