nb-enDR3-TEV-mEGFP-NLS (pRS1458)
(Plasmid
#240547)
-
PurposeExpression of negative control for R-loops capture experiments using enDR3. A mutated, non-R-loops binding version of enDR3 is expressed in fusion with the TEV cleavage site, mEGFP, and NLS.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenb-enDR3
-
SpeciesGeobacillus stearothermophilus
-
MutationS48A, K50A
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAATGCGATGCAATTTCCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nb-enDR3-TEV-mEGFP-NLS (pRS1458) was a gift from Roman Szczęsny (Addgene plasmid # 240547 ; http://n2t.net/addgene:240547 ; RRID:Addgene_240547) -
For your References section:
Genome-wide in vivo and ex vivo mapping of R-loops using engineered N-terminal hybrid-binding domain of RNase H3 (enDR3). Jedynak-Slyvka M, Kaczmarska Z, Graczyk D, Jurkiewicz A, Figiel M, Borowski LS, Szczesny RJ, Nowotny M. Nucleic Acids Res. 2025 Aug 11;53(15):gkaf792. doi: 10.1093/nar/gkaf792. 10.1093/nar/gkaf792 PubMed 40823807