Skip to main content
Addgene

nb-enDR3-TEV-mEGFP-NLS (pRS1458)
(Plasmid #240547)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240547 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nb-enDR3
  • Species
    Geobacillus stearothermophilus
  • Mutation
    S48A, K50A

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAATGCGATGCAATTTCCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nb-enDR3-TEV-mEGFP-NLS (pRS1458) was a gift from Roman Szczęsny (Addgene plasmid # 240547 ; http://n2t.net/addgene:240547 ; RRID:Addgene_240547)
  • For your References section:

    Genome-wide in vivo and ex vivo mapping of R-loops using engineered N-terminal hybrid-binding domain of RNase H3 (enDR3). Jedynak-Slyvka M, Kaczmarska Z, Graczyk D, Jurkiewicz A, Figiel M, Borowski LS, Szczesny RJ, Nowotny M. Nucleic Acids Res. 2025 Aug 11;53(15):gkaf792. doi: 10.1093/nar/gkaf792. 10.1093/nar/gkaf792 PubMed 40823807