pLLOXmPOLBeta
(Plasmid
#24174)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiLox3.7
-
Backbone manufacturerObtained from MIT vector core
- Backbone size w/o insert (bp) 70000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepLLOXmPOLbeta
-
Alt nameMouse Polymerase Beta shRNA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)65
-
Mutationx
-
GenBank IDNM_011130
-
Entrez GenePolb (a.k.a. A430088C08Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XnoI (destroyed during cloning)
- 5′ sequencing primer X
- 3′ sequencing primer X
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone obtained from MIT vector core
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA oligo sequence is - 5'-TGATCAGTACTACTGTGGTGTTCAAGAGACACCACAGTAGTACTGATCTTTTTTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLLOXmPOLBeta was a gift from Robert Sobol (Addgene plasmid # 24174 ; http://n2t.net/addgene:24174 ; RRID:Addgene_24174) -
For your References section:
Parp1 activation in mouse embryonic fibroblasts promotes Pol beta-dependent cellular hypersensitivity to alkylation damage. Jelezcova E, Trivedi RN, Wang XH, Tang JB, Brown AR, Goellner EM, Schamus S, Fornsaglio JL, Sobol RW. Mutat Res. 2010 Apr 1;686(1-2):57-67. doi: 10.1016/j.mrfmmm.2010.01.016. Epub 2010 Jan 22. 10.1016/j.mrfmmm.2010.01.016 PubMed 20096707