pCAG coca-GlyR-IRES-GFP
(Plasmid
#242194)
-
PurposeExpression vector for cocaine-gated chemogenetic anion channel
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG IRES eGFP WPRE
- Backbone size w/o insert (bp) 5618
- Total vector size (bp) 8606
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecoca-GlyR-IRES-GFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2988
-
MutationL141G G175K Y217F
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer cgtcgccgtccagctcgaccag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG coca-GlyR-IRES-GFP was a gift from Scott Sternson (Addgene plasmid # 242194 ; http://n2t.net/addgene:242194 ; RRID:Addgene_242194) -
For your References section:
Cocaine chemogenetics blunts drug-seeking by synthetic physiology. Gomez JL, Magnus CJ, Bonaventura J, Solis O, Curry FP, Levinstein MR, Budinich RC, Carlton ML, Ventriglia EN, Lam S, Wang L, Schoenborn I, Dunne W, Michaelides M, Sternson SM. Nature. 2025 Aug 27. doi: 10.1038/s41586-025-09427-8. 10.1038/s41586-025-09427-8 PubMed 40866713