Skip to main content

AAV Syn-FLEX-coca-GlyR-IRES-mCherry
(Plasmid #242196)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242196 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV Syn FLEX rev IRES mcherry
  • Backbone size w/o insert (bp) 5162
  • Total vector size (bp) 7541
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Syn-FLEX-coca-GlyR-IRES-mCherry
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2379
  • Mutation
    L141G G175K Y217F
  • Promoter Synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtaagtatcaaggttacaag
  • 3′ sequencing primer ctgacaacgggccacaactc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV Syn-FLEX-coca-GlyR-IRES-mCherry was a gift from Scott Sternson (Addgene plasmid # 242196 ; http://n2t.net/addgene:242196 ; RRID:Addgene_242196)
  • For your References section:

    Cocaine chemogenetics blunts drug-seeking by synthetic physiology. Gomez JL, Magnus CJ, Bonaventura J, Solis O, Curry FP, Levinstein MR, Budinich RC, Carlton ML, Ventriglia EN, Lam S, Wang L, Schoenborn I, Dunne W, Michaelides M, Sternson SM. Nature. 2025 Aug 27. doi: 10.1038/s41586-025-09427-8. 10.1038/s41586-025-09427-8 PubMed 40866713