FUGW-EGFP-mHif1a
(Plasmid
#242809)
-
PurposeLentiviral vector expressing mouse Hif1a tagged with an N-terminal EGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW
- Backbone size w/o insert (bp) 9221
- Total vector size (bp) 12449
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHypoxia-inducible factor 1, alpha subunit
-
Alt nameHif1a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2511
-
Entrez GeneHif1a (a.k.a. HIF-1-alpha, HIF1-alpha, HIF1alpha, MOP1, bHLHe78)
- Promoter Ubiquitin C
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGAAGCTCCGGTTTTGAACT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUGW-EGFP-mHif1a was a gift from Ronald Hart (Addgene plasmid # 242809 ; http://n2t.net/addgene:242809 ; RRID:Addgene_242809) -
For your References section:
Alpha-ketoglutarate mitigates insulin resistance and metabolic inflexibility in a mouse model of Ataxia-Telangiectasia. Sun JK, Hart RP, Herrup K, Peng AZ, Wong GC, Wu D, Kwan KM, Chow KH. Nat Commun. 2025 Oct 21;16(1):9312. doi: 10.1038/s41467-025-64360-8. 10.1038/s41467-025-64360-8 PubMed 41120320