Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMIG-W-Flag-Nbs1
(Plasmid #89315)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89315 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMIG-W
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nbs1
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nbn (a.k.a. Nbs1)
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGTCTCTCCCCCTTGAACCTCCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Flag tagged mNbs1 (2-751aa)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIG-W-Flag-Nbs1 was a gift from John Petrini (Addgene plasmid # 89315 ; http://n2t.net/addgene:89315 ; RRID:Addgene_89315)
  • For your References section:

    The Mre11-Nbs1 Interface Is Essential for Viability and Tumor Suppression. Kim JH, Grosbart M, Anand R, Wyman C, Cejka P, Petrini JH. Cell Rep. 2017 Jan 10;18(2):496-507. doi: 10.1016/j.celrep.2016.12.035. 10.1016/j.celrep.2016.12.035 PubMed 28076792