pAG mIgG2a Empty
(Plasmid #242953)

• Purpose: (Empty Backbone) Expresses mouse IgG2a heavy chain constant region. Users can clone in their desired heavy chain variable region for mammalian expression; to be used with pAG mKappa Empty light chain (Plasmid 242954)
• Depositing Labs: Meghan Rego, Addgene Research Program
• Publication: Addgene Antibody Plasmids (unpublished)

Backbone

• Vector backbone: pAG AB
• Backbone manufacturer: Addgene
• Backbone size (bp): 4913
• Vector type: Mammalian Expression
• Promoter: CMV
• Tag / Fusion Protein:
  • Mouse IgG2a (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggccctcgaggacgccagca
• 3′ sequencing primer: gcgcgcccaacagccccatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Plasmid 242953 pAG mIgG2a Empty encodes the mouse IgG2a heavy chain constant region and a filler sequence in lieu of a heavy chain variable region. To clone in your desired heavy chain variable region in frame with the mouse IgG2a heavy chain constant region, Addgene recommends the NEB Hifi assembly method.

PCR Amplify the backbone from plasmid 242953 pAG mIgG2a Empty with the following primers: 5’-ggccctcgaggacgccagca and 5’-gcgcgcccaacagccccatc.

Synthesize a gene fragment of the desired heavy chain variable region with flanking sequences that overlap with the backbone PCR product 5’-tgctggcgtcctcgagggcc-Gene fragment-gcgcgcccaacagccccatc

Assemble with the NEB HiFI assembly (NEB #E2621S) following the manufacturer’s recommendations.