pAG mIgG2a Empty
(Plasmid
#242953)
-
Purpose(Empty Backbone) Expresses mouse IgG2a heavy chain constant region. Users can clone in their desired heavy chain variable region for mammalian expression; to be used with pAG mKappa Empty light chain (Plasmid 242954)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242953 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepAG AB
-
Backbone manufacturerAddgene
- Backbone size (bp) 4913
-
Vector typeMammalian Expression
- Promoter CMV
-
Tag
/ Fusion Protein
- Mouse IgG2a (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggccctcgaggacgccagca
- 3′ sequencing primer gcgcgcccaacagccccatc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid 242953 pAG mIgG2a Empty encodes the mouse IgG2a heavy chain constant region and a filler sequence in lieu of a heavy chain variable region. To clone in your desired heavy chain variable region in frame with the mouse IgG2a heavy chain constant region, Addgene recommends the NEB Hifi assembly method.
PCR Amplify the backbone from plasmid 242953 pAG mIgG2a Empty with the following primers: 5’-ggccctcgaggacgccagca and 5’-gcgcgcccaacagccccatc.
Synthesize a gene fragment of the desired heavy chain variable region with flanking sequences that overlap with the backbone PCR product 5’-tgctggcgtcctcgagggcc-Gene fragment-gcgcgcccaacagccccatc
Assemble with the NEB HiFI assembly (NEB #E2621S) following the manufacturer’s recommendations.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG mIgG2a Empty was a gift from Meghan Rego & Addgene Research Program (Addgene plasmid # 242953 ; http://n2t.net/addgene:242953 ; RRID:Addgene_242953)