pAG mKappa Anti-c-Myc [9E10]
(Plasmid
#242956)
-
PurposeMammalian expression plasmid for Anti-c-Myc [9E10] fused to mouse kappa light chain constant region; to be used with pAG mIgG2a Anti-c-Myc [9E10] heavy chain (Plasmid 242955) to make the antibody.
-
Depositing Labs
-
Publication
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepAG mKappa Empty
-
Backbone manufacturerAddgene Research Program (Addgene plasmid # 242954)
- Total vector size (bp) 4572
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-c-Myc [9E10] light chain variable region fused to mouse kappa light chain constant region
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)714
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggctgatgctgcaccaac
- 3′ sequencing primer ggccctcgaggacgccagca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG mKappa Anti-c-Myc [9E10] was a gift from Meghan Rego & Addgene Research Program (Addgene plasmid # 242956 ; http://n2t.net/addgene:242956 ; RRID:Addgene_242956)
Map uploaded by the depositor.
