IronFistMUT.
(Plasmid
#243008)
-
PurposeIron binding deficient IronFist
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 243008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneVector Builder
-
Backbone manufacturerVector Builder
- Total vector size (bp) 4827
-
Vector typeMammalian Expression ; Gateway
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namehemerythrin-like-mNeonGreen
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
MutationH15A, H57A, E58A, E61A, H126A, E130A
-
Entrez GeneFBXL5 (a.k.a. FBL4, FBL5, FLR1)
- Promoter human phosphoglycerate kinase (hPGK)
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer cctataaaaataggcgtatc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameT2A
-
Alt nameRibosomal skipping sequence
-
Insert Size (bp)63
Gene/Insert 3
-
Gene/Insert namemCherry
-
Insert Size (bp)711
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWe have ordered it from Vector Builder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IronFistMUT. was a gift from Roland Malli (Addgene plasmid # 243008 ; http://n2t.net/addgene:243008 ; RRID:Addgene_243008) -
For your References section:
Tracking Intracellular Labile Iron with a Genetically Encoded Fluorescent Reporter System Based on Protein Stability. Akyol A, Cimen S, Gottschalk B, Erdogan YC, Lischnig A, Barton Alston A, Digigow R, Fluhmann B, Eroglu E, Graier WF, Malli R. ACS Sens. 2025 Aug 22;10(8):5854-5861. doi: 10.1021/acssensors.5c01165. Epub 2025 Aug 1. 10.1021/acssensors.5c01165 PubMed 40747620