Skip to main content

pAC-QF
(Plasmid #24338)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24338 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPac5c-PL
  • Backbone size w/o insert (bp) 6400
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QF
  • Species
    Neurospora crassa
  • Insert Size (bp)
    2450

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer AC5
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

QF cDNA was obtained by PCR using primers PR50
(aatggatcccaacatgccgcctaaacgcaagac) and PR51 (aatgcggccgcctattgctcatacgtgttgatatcg), and the
cosmid, pLorist-HO35F3 from the Fungal Genetics Stock Center, as the template. The PCR
fragment was cloned into pPAC5C-PL using BamHI and NotI. The QF gene is intronless.

A newer version of this plasmid is now available - pAC-7-QFBDAD www.addgene.org/46096 (Addgene plasmid # 46096)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC-QF was a gift from Liqun Luo (Addgene plasmid # 24338 ; http://n2t.net/addgene:24338 ; RRID:Addgene_24338)
  • For your References section:

    The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Potter CJ, Tasic B, Russler EV, Liang L, Luo L. Cell. 2010 Apr 30. 141(3):536-48. 10.1016/j.cell.2010.02.025 PubMed 20434990