-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPac5c-PL
- Backbone size w/o insert (bp) 6400
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQF
-
SpeciesNeurospora crassa
-
Insert Size (bp)2450
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer AC5
- (Common Sequencing Primers)
Resource Information
-
Reference
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
QF cDNA was obtained by PCR using primers PR50
(aatggatcccaacatgccgcctaaacgcaagac) and PR51 (aatgcggccgcctattgctcatacgtgttgatatcg), and the
cosmid, pLorist-HO35F3 from the Fungal Genetics Stock Center, as the template. The PCR
fragment was cloned into pPAC5C-PL using BamHI and NotI. The QF gene is intronless.
A newer version of this plasmid is now available - pAC-7-QFBDAD www.addgene.org/46096 (Addgene plasmid # 46096)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC-QF was a gift from Liqun Luo (Addgene plasmid # 24338 ; http://n2t.net/addgene:24338 ; RRID:Addgene_24338) -
For your References section:
The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Potter CJ, Tasic B, Russler EV, Liang L, Luo L. Cell. 2010 Apr 30. 141(3):536-48. 10.1016/j.cell.2010.02.025 PubMed 20434990