pCMV-QS
(Plasmid
#24340)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1-Myc-His-A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5493
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQS
-
SpeciesNeurospora crassa
-
Insert Size (bp)2750
-
Tags
/ Fusion Proteins
- Myc (C terminal on insert)
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Acc65I (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CMV-F
- (Common Sequencing Primers)
Resource Information
-
Reference
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
QS cDNA was obtained by PCR using primers PR53
(aatggtacccaacatgaacaccatcccggcac) and PR54 (aatgcggccgctcaagatatttgcgttgcaattc) using a
cosmid, pLorist-HO35F3 from the Fungal Genetics Stock Center, as the template. The PCR
fragment was initially cloned into pPAC5C-PL using Acc65 I and NotI to obtain the QS gene
containing a single intron. The intron was subsequently removed by creating two PCR products that
were cloned using 3-way ligation into pCDNA3.1-Mys-His-A (Invitrogen) using Acc65I and NotI and
blunt ends at the exon-exon junction. The primers used to create the first exon are: PR53 (see
above) + PR190 (agagcctagaggtactctgtgggcgg); and the second exon are: PR58
(tggtcggcgcccaattcc) + PR54 (see above).
A stop codon precedes the Myc and His tags.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-QS was a gift from Liqun Luo (Addgene plasmid # 24340 ; http://n2t.net/addgene:24340 ; RRID:Addgene_24340) -
For your References section:
The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Potter CJ, Tasic B, Russler EV, Liang L, Luo L. Cell. 2010 Apr 30. 141(3):536-48. 10.1016/j.cell.2010.02.025 PubMed 20434990