Mito4x-LA-GCaMP6s
(Plasmid
#243810)
-
PurposeExpresses a low affinity (LA) calcium sensor directed to the mitochondrial matrix
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 243810 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 7143
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMito4x-LAGCaMP6s
-
SpeciesSynthetic
-
MutationD362I
- Promoter CMV
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInvitrogene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mito4x-LA-GCaMP6s was a gift from Jaime de Juan-Sanz (Addgene plasmid # 243810 ; http://n2t.net/addgene:243810 ; RRID:Addgene_243810) -
For your References section:
Mitochondrial Ca(2+) efflux controls neuronal metabolism and long-term memory across species. Amrapali Vishwanath A, Comyn T, Mira RG, Brossier C, Pascual-Caro C, Faour M, Boumendil K, Chintaluri C, Ramon-Duaso C, Fan R, Ghosh K, Farrants H, Berwick JP, Sivakumar R, Lopez-Manzaneda M, Schreiter ER, Preat T, Vogels TP, Rangaraju V, Busquets-Garcia A, Placais PY, Pavlowsky A, de Juan-Sanz J. Nat Metab. 2026 Feb 11. doi: 10.1038/s42255-026-01451-w. 10.1038/s42255-026-01451-w PubMed 41673453