pADH99Cau
(Plasmid
#244807)
-
PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma auris
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepADH99
-
Backbone manufacturerNamkha Nguyen
- Backbone size w/o insert (bp) 2226
- Total vector size (bp) 11734
-
Modifications to backboneChanged the C. albicans HIS1 promoter and ENO1 promoter sequences with the C. auris ones.
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions100µg/mL Ampicillin
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCauHIS1_US
-
SpeciesC. auris
-
Insert Size (bp)1447
-
Tags
/ Fusion Proteins
- C. albicans codon optimized Cas9
- C. albicans MAL2 promoter
- S. cerevisiae FLP recombinase
- NAT resistance (first half)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATTTGCAGCTGGTAAATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.09.632232 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADH99Cau was a gift from Patrick Van Dijck (Addgene plasmid # 244807 ; http://n2t.net/addgene:244807 ; RRID:Addgene_244807) -
For your References section:
A comparative evaluation of CRISPR-Cas9 allele editing systems in Candida auris: challenging research in a challenging bug. Sofras D, Carolus H, Subotic A, Romero CL, Ennis CL, Hernday AD, Nobile CJ, Rybak JM, Van Dijck P. bioRxiv [Preprint]. 2025 Jan 11:2025.01.09.632232. doi: 10.1101/2025.01.09.632232. 10.1101/2025.01.09.632232 PubMed 39829791