Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #24593)


Item Catalog # Description Quantity Price (USD)
Plasmid 24593 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV Retrograde 24593-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4500
  • Vector type
    AAV, Cre/Lox ; Adeno-associated

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Cre recombinase (codon optimized)
  • Alt name
    Cre recombinase
  • Species
    codon optimized cDNA
  • Insert Size (bp)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TCTTATCTTCCTCCCACAGC
  • 3′ sequencing primer hGH-PA-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Information for AAV Retrograde (Catalog # 24593-AAVrg) ( Back to top )


Ready-to-use AAV Retrograde particles produced from AAV-pgk-Cre (#24593). In addition to the viral particles, you will also receive purified AAV-pgk-Cre plasmid DNA.

Cre expression under the PGK promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-pgk-Cre was a gift from Patrick Aebischer (Addgene plasmid # 24593 ; ; RRID:Addgene_24593)

    For viral preps, please replace (Addgene plasmid # 24593) in the above sentence with: (Addgene viral prep # 24593-AAVrg)