pcDNA3.1-CMV-Vega
(Plasmid
#246323)
-
PurposePhotostable genetically encoded voltage indicator for imaging in HEK293T
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5595
- Total vector size (bp) 7925
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVega
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATGGCTGACGTGGAAACCG
- 3′ sequencing primer TTACACCTCGTTCTCGTAGCAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.29.656768 for the bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CMV-Vega was a gift from Peng Zou (Addgene plasmid # 246323 ; http://n2t.net/addgene:246323 ; RRID:Addgene_246323) -
For your References section:
A photostable genetically encoded voltage indicator for imaging neural activities in tissue and live animals. Cao C, Ruixin Zhu, Zhou S, Zhao Z, Lin C, Liu S, Peng L, Subach FV, Piatkevich KD, Zou P. bioRxiv 2025.05.29.656768 10.1101/2025.05.29.656768