pAAV-hSyn-Vega
(Plasmid
#246324)
-
PurposePhotostable genetically encoded voltage indicator for imaging in rat hippocampal neurons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4530
- Total vector size (bp) 6864
-
Vector typeMammalian Expression, Mouse Targeting, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVega
-
SpeciesSynthetic
- Promoter Synapsin
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATGGCTGACGTGGAAACCG
- 3′ sequencing primer TTACACCTCGTTCTCGTAGCAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.29.656768 for the bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-Vega was a gift from Peng Zou (Addgene plasmid # 246324 ; http://n2t.net/addgene:246324 ; RRID:Addgene_246324) -
For your References section:
A photostable genetically encoded voltage indicator for imaging neural activities in tissue and live animals. Cao C, Ruixin Zhu, Zhou S, Zhao Z, Lin C, Liu S, Peng L, Subach FV, Piatkevich KD, Zou P. bioRxiv 2025.05.29.656768 10.1101/2025.05.29.656768