pMini-CMV-NLS-R-IscB-VR4-NLS (D60A, H243E, H269N, R270Q)_T2A_mCherry_U6-ωRNA
(Plasmid
#246431)
-
PurposeAll-in-one plasmid. Expresses R-IscB in mammalian cells. ssRNase enhancing mutations (H243E, H269N, R270Q) included.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMini
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameO.gue IscB-VR4 (H243E, H269N, R270Q) with RuvC dead mutations (D60A) and delta-TID
-
SpeciesSynthetic; human gut metagenome
-
Insert Size (bp)1323
-
Mutationchanged Aspartic Acid 60 to Alanine, changed Histidine 243 to Glutamic acid, changed Histidine 269 to Asparagine, changed Arginine 270 to Glutamine, deleted amino acids 433-487
-
GenBank IDOGEU01000025.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- nucleoplasmin NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer gggccgggattttcctcc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter CMV
-
Tag
/ Fusion Protein
- Thosea asigna virus 2A peptide (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gggtccaaaaggccgg
- 3′ sequencing primer TGGCTGGCAACTAGAAGG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameωRNA
-
Specieshuman gut metagenome
-
Insert Size (bp)194
-
GenBank IDOGEU01000025.1
- Promoter U6
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATG
- 3′ sequencing primer gatttgccctcccatatg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMini-CMV-NLS-R-IscB-VR4-NLS (D60A, H243E, H269N, R270Q)_T2A_mCherry_U6-ωRNA was a gift from Ailong Ke (Addgene plasmid # 246431 ; http://n2t.net/addgene:246431 ; RRID:Addgene_246431) -
For your References section:
Conversion of IscB and Cas9 into RNA-guided RNA editors. Xu C, Niu X, Sun H, Yan H, Tang W, Ke A. Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032. 10.1016/j.cell.2025.07.032 PubMed 40829585