pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
(Plasmid
#246432)
-
PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMini
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain
-
Alt nameR-IscB-ADAR2dd
-
SpeciesH. sapiens (human), Synthetic; human gut metagenome
-
Insert Size (bp)2479
-
MutationR-IscB: changed Aspartic Acid 60 to Alanine, changed Histidine 269 to Alanine, deleted amino acids 433-487. ADAR2: Only the deaminase domain (AA 276-702 are expressed). Glutamate 488 is mutated to glutamine.
-
GenBank IDOGEU01000025.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker between R-IscB and ADAR2dd
- HIV NES (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
-
Mutationchanged tryptophan 98 to premature stop codon
- Promoter CMV
-
Tag
/ Fusion Protein
- Thosea asigna virus 2A peptide (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cactcacgggatcccttca
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameωRNA
-
SpeciesSynthetic; human gut metagenome
-
Insert Size (bp)242
-
GenBank IDOGEU01000025.1
- Promoter U6
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gagggcctatttcccatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA was a gift from Ailong Ke (Addgene plasmid # 246432 ; http://n2t.net/addgene:246432 ; RRID:Addgene_246432) -
For your References section:
Conversion of IscB and Cas9 into RNA-guided RNA editors. Xu C, Niu X, Sun H, Yan H, Tang W, Ke A. Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032. 10.1016/j.cell.2025.07.032 PubMed 40829585