pMini-CMV-NLS-dead R-IscB-NLS_T2A_EGFP (Y67X)_LNMA intron
(Plasmid
#246435)
-
PurposeExpresses inactive EGFP (Y67X) in mammalian cells for trans-splicing assessments. LMNA intron is inserted into EGFP CDS.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246435 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMini
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameO.gue IscB with dead mutations (D60A, H269A) and delta-TID
-
SpeciesSynthetic; human gut metagenome
-
Insert Size (bp)1323
-
Mutationchanged Aspartic Acid 60 to Alanine, changed Histidine 269 to Alanine, deleted amino acids 433-487
-
GenBank IDOGEU01000025.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- nucleoplasmin NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)711
-
Mutationchanged Tyrosine 67 to premature stop codon. LMNA intron inserted between Glutamine 95 and Glutamic acid 96 to mimick cis-splicing
- Promoter CMV
-
Tag
/ Fusion Protein
- Thosea asigna virus 2A peptide (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer aacggcggactgcagatctacg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMini-CMV-NLS-dead R-IscB-NLS_T2A_EGFP (Y67X)_LNMA intron was a gift from Ailong Ke (Addgene plasmid # 246435 ; http://n2t.net/addgene:246435 ; RRID:Addgene_246435) -
For your References section:
Conversion of IscB and Cas9 into RNA-guided RNA editors. Xu C, Niu X, Sun H, Yan H, Tang W, Ke A. Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032. 10.1016/j.cell.2025.07.032 PubMed 40829585