pMini-CMV-NLS-dead R-IscB-NLS_T2A_EGFP (Y67X)_LNMA intron
(Plasmid #246435)

• Purpose: Expresses inactive EGFP (Y67X) in mammalian cells for trans-splicing assessments. LMNA intron is inserted into EGFP CDS.
• Depositing Lab: Ailong Ke
• Publication: Xu et al Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032.

Backbone

• Vector backbone: pMini
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: O.gue IscB with dead mutations (D60A, H269A) and delta-TID
• Species: Synthetic; human gut metagenome
• Insert Size (bp): 1323
• Mutation: changed Aspartic Acid 60 to Alanine, changed Histidine 269 to Alanine, deleted amino acids 433-487
• GenBank ID: OGEU01000025.1
• Promoter: CMV
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • nucleoplasmin NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Gene/Insert 2

• Gene/Insert name: EGFP
• Species: Synthetic
• Insert Size (bp): 711
• Mutation: changed Tyrosine 67 to premature stop codon. LMNA intron inserted between Glutamine 95 and Glutamic acid 96 to mimick cis-splicing
• Promoter: CMV
• Tag / Fusion Protein:
  • Thosea asigna virus 2A peptide (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aacggcggactgcagatctacg

Resource Information

• Supplemental Documents:
  • E5TS3_30_pYAO_CMV_dWT4mutdTID_T2A_mCherry_trans_splicing Y67stop 5end tempalte_rm wRNA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry