Skip to main content

pMini-CMV-NLS-dead R-IscB-NLS_T2A_mCherry_U1a-EGFP trans-splicing ωRNA
(Plasmid #246436)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246436 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMini
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    O.gue IscB with dead mutations (D60A, H269A) and delta-TID
  • Species
    Synthetic; human gut metagenome
  • Insert Size (bp)
    1323
  • Mutation
    changed Aspartic Acid 60 to Alanine, changed Histidine 269 to Alanine, deleted amino acids 433-487
  • GenBank ID
    OGEU01000025.1
  • Promoter CMV
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • nucleoplasmin NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer gggccgggattttcctcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Promoter CMV
  • Tag / Fusion Protein
    • Thosea asigna virus 2A peptide (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gggtccaaaaggccgg
  • 3′ sequencing primer CTGGCAACTAGAAGGCAC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    ωRNA with trans-splicing template
  • Species
    human gut metagenome
  • Insert Size (bp)
    518
  • Mutation
    GFP N-terminal sequence M1 to Glutamine 95 appended at 5' end to induce trans-splicing. Partial Intron appended at 5' end for splicing donor site recognition.
  • GenBank ID
    OGEU01000025.1
  • Promoter U1a
  • Tags / Fusion Proteins
    • GFP N-terminal sequence (M1 to Q95) (N terminal on insert)
    • Hemi Intron (GTAAGAGAGCTCGTTGCGATATTAT) (N terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttcaggctccgtggccac
  • 3′ sequencing primer Ggatttgccctcccatatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMini-CMV-NLS-dead R-IscB-NLS_T2A_mCherry_U1a-EGFP trans-splicing ωRNA was a gift from Ailong Ke (Addgene plasmid # 246436 ; http://n2t.net/addgene:246436 ; RRID:Addgene_246436)
  • For your References section:

    Conversion of IscB and Cas9 into RNA-guided RNA editors. Xu C, Niu X, Sun H, Yan H, Tang W, Ke A. Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032. 10.1016/j.cell.2025.07.032 PubMed 40829585