Skip to main content

sh-hCHIP
(Plasmid #246751)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246751 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Vector type
    Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sh-hCHIP
  • gRNA/shRNA sequence
    CCCAAGTTCTGCTGTTGGACT
  • Species
    H. sapiens (human)
  • Entrez Gene
    STUB1 (a.k.a. CHIP, HSPABP2, NY-CO-7, SCA48, SCAR16, SDCCAG7, UBOX1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.02.18.638932 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sh-hCHIP was a gift from Yihong Ye (Addgene plasmid # 246751 ; http://n2t.net/addgene:246751 ; RRID:Addgene_246751)
  • For your References section:

    CHIP protects lysosomes from CLN4 mutant-induced membrane damage. Lee J, Chin N, Zou J, Mazli WNAB, Jarnik M, Saidi L, Xu Y, Jeong E, Suh J, Replogle J, Ward ME, Bonifacino JS, Zheng W, Hao L, Ye Y. Nat Cell Biol. 2025 Aug 25. doi: 10.1038/s41556-025-01738-2. 10.1038/s41556-025-01738-2 PubMed 40855364