sh-hCHIP
(Plasmid
#246751)
-
PurposeMammalian and lentiviral expression of shRNA targeting human CHIP (Stub1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Vector typeLentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesh-hCHIP
-
gRNA/shRNA sequenceCCCAAGTTCTGCTGTTGGACT
-
SpeciesH. sapiens (human)
-
Entrez GeneSTUB1 (a.k.a. CHIP, HSPABP2, NY-CO-7, SCA48, SCAR16, SDCCAG7, UBOX1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.18.638932 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sh-hCHIP was a gift from Yihong Ye (Addgene plasmid # 246751 ; http://n2t.net/addgene:246751 ; RRID:Addgene_246751) -
For your References section:
CHIP protects lysosomes from CLN4 mutant-induced membrane damage. Lee J, Chin N, Zou J, Mazli WNAB, Jarnik M, Saidi L, Xu Y, Jeong E, Suh J, Replogle J, Ward ME, Bonifacino JS, Zheng W, Hao L, Ye Y. Nat Cell Biol. 2025 Aug 25. doi: 10.1038/s41556-025-01738-2. 10.1038/s41556-025-01738-2 PubMed 40855364