pmMBD1.7G (pc3343)
(Plasmid
#246870)
-
PurposeMammalian expression plasmid of full length MBD1 with pointmutations C289 and 292A. C-terminal tagged to GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMX
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 7058
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMBD1
-
SpeciesM. musculus (mouse)
-
MutationPointmutations C289,292A
-
Entrez GeneMbd1 (a.k.a. Cxxc3, PCM1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmMBD1.7G (pc3343) was a gift from Cristina Cardoso (Addgene plasmid # 246870 ; http://n2t.net/addgene:246870 ; RRID:Addgene_246870) -
For your References section:
Methyl-CpG binding domain protein 1 regulates localization and activity of Tet1 in a CXXC3 domain-dependent manner. Zhang P, Rausch C, Hastert FD, Boneva B, Filatova A, Patil SJ, Nuber UA, Gao Y, Zhao X, Cardoso MC. Nucleic Acids Res. 2017 Apr 25. doi: 10.1093/nar/gkx281. 10.1093/nar/gkx281 PubMed 28449087