shMyb-1
(Plasmid
#247030)
-
PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid Progenitors
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.8
-
Backbone manufacturerJun Lu Lab, Yale University
- Total vector size (bp) 7312
-
Modifications to backboneinserted shMyb-1 sequence into backbone
-
Vector typeLentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshMYB-1
-
gRNA/shRNA sequenceaacaccggccagattgtaaatgctcatttctcgagaaatgagcatttacaatctgg
-
SpeciesH. sapiens (human)
-
Entrez GeneMYB (a.k.a. Cmyb, c-myb, c-myb_CDS, efg)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ggcctatttcccatgattcct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shMyb-1 was a gift from Diane Krause (Addgene plasmid # 247030 ; http://n2t.net/addgene:247030 ; RRID:Addgene_247030) -
For your References section:
Adult human megakaryocyte-erythroid progenitors are in the CD34+CD38mid fraction. Sanada C, Xavier-Ferrucio J, Lu YC, Min E, Zhang PX, Zou S, Kang E, Zhang M, Zerafati G, Gallagher PG, Krause DS. Blood. 2016 Aug 18;128(7):923-33. doi: 10.1182/blood-2016-01-693705. Epub 2016 Jun 6. 10.1182/blood-2016-01-693705 PubMed 27268089