Skip to main content
Addgene
Open Menu

shMYB-2
(Plasmid #247031)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247031 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pLKO.8
  • Backbone manufacturer
    Jun Lu Lab, Yale University
  • Total vector size (bp) 7312
  • Modifications to backbone
    inserted shMyb-2 sequence into backbone
  • Vector type
    Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shMYB-2
  • gRNA/shRNA sequence
    aacaccgggaacagaatggaacagatgacctcgaggtcatctgttccattctgttc
  • Species
    H. sapiens (human)
  • Entrez Gene
    MYB (a.k.a. Cmyb, c-myb, c-myb_CDS, efg)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ggcctatttcccatgattcct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shMYB-2 was a gift from Diane Krause (Addgene plasmid # 247031 ; http://n2t.net/addgene:247031 ; RRID:Addgene_247031)

  • For your References section:

    Adult human megakaryocyte-erythroid progenitors are in the CD34+CD38mid fraction. Sanada C, Xavier-Ferrucio J, Lu YC, Min E, Zhang PX, Zou S, Kang E, Zhang M, Zerafati G, Gallagher PG, Krause DS. Blood. 2016 Aug 18;128(7):923-33. doi: 10.1182/blood-2016-01-693705. Epub 2016 Jun 6. 10.1182/blood-2016-01-693705 PubMed 27268089
Related items: