pLminP_Luc2P_RE56
(Plasmid
#247034)
-
PurposeGlucocorticoid Receptor pathway reporter; lentiviral expression of NR3C1 (GR) DNA response element cloned 5' to firefly luciferase. Coexpresses EmGFP to monitor lentiviral transduction.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti7.3
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 7251
-
Vector typeLentiviral
-
Selectable markersEmGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
SpeciesP. pyralis
-
Insert Size (bp)1776
- Promoter NR3C1 (GR)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPromega; derived from pGL4.29 reporter vector
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLminP_Luc2P_RE56 was a gift from Ramnik Xavier (Addgene plasmid # 247034 ; http://n2t.net/addgene:247034 ; RRID:Addgene_247034) -
For your References section:
Simultaneous Pathway Activity Inference and Gene Expression Analysis Using RNA Sequencing. O'Connell DJ, Kolde R, Sooknah M, Graham DB, Sundberg TB, Latorre IJ, Mikkelsen TS, Xavier RJ. Cell Syst. 2016 May 25;2(5):323-34. doi: 10.1016/j.cels.2016.04.011. Epub 2016 May 19. 10.1016/j.cels.2016.04.011 PubMed 27211859